Leguminosin group485 secreted peptide

Author: sgjr

August undefined, 2024

NettetThe α-thymosins belong to a group of peptides isolated for the first time from calf thymus extracts, denominated Thymosin fraction 5 (TF5) (Goldstein, Guha, Zatz, Hardy, & … NettetLegumin is the main storage protein of leguminous seeds. In broad bean, for instance, 75% of the total storage protein consists of legumin. Legumin is a hexamer with a …

(PDF) Identifying Temporally Regulated Root Nodulation

NettetUniProtKB. x; UniProtKB. Protein knowledgebase. UniParc. Sequence archive. Help. Help pages, FAQs, UniProtKB manual, documents, news archive and Biocuration projects. NettetLegumin is a conjugated protein with six subunits. The individual subunits have a hydrophilic α chain that is initially linked to the smaller hydrophobic β chain with a … riced beets

Legumin - an overview ScienceDirect Topics

Nettet1. jun. 2024 · These proteins have been proposed to be secreted through the excyst-positive organelle (EXPO)—a double-membrane organelle whose formation is Golgi- and TGN-independent. The EXPOs can fuse with... NettetProtein Length: 128: SignalP D-value: 0.631: SSP Type: putative SSP: SSP Gene Family Name: Family_01: Putative SSP Family ID: Family_01: Annotation: leguminosin group485 secreted peptide conf_class=HC NettetGene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. LOC25488434 cuticle collagen 2 [ (barrel medic)] Gene ID: … rediffmail account recovery

Advances and perspectives in discovery and functional analysis …

assets.researchsquare.com

NettetUniProt G7KAG0 · G7KAG0_MEDTR Protein Leguminosin group485 secreted peptide Gene 11442299 Status UniProtKB unreviewed (TrEMBL) Organism Medicago … NettetLegend: 6w mi482 Ri vs 6w WT Si: 6 week after infection mi482 resistant inocultated with Phytophthora infestans vs wildtype susceptible inoculated 6w mi2118b Ri vs 6w WT Si: 6 wee rediffmail account sign inNettetGene Assembly Chromossome Coordinates SSP Type SSP Family member SignalP D-value Protein Length Annotation; Medtr1g074410: Mt4.0v1: chr1: 33057168-33059084: known SSP riced camry

"NettetThe insert in this plasmid (pENTR-STTM) was then LR recombined into pGWB402 destination vector 20 containing a 2X35S promoter driving the expression of the insert, and kanamycin-resistant marker (NOS promoter:NPTII:NOS 21 terminator) for selection. All constructs were conﬁrmed by Sanger sequencing. 22 Small RNA northern blot. " - Leguminosin group485 secreted peptide

Leguminosin group485 secreted peptide

Frontiers Small secreted peptides encoded on the wheat (Triticum ...

NettetPeptide chain release factor 1 AT1G10970.2 zinc transporter tr A0A0K9PL91 A0A0K9PL91_ZOSMR Copper ion binding protein tr Q9FW91 Q9FW91_ORYSJ ... Leguminosin group485 secreted peptide tr Q40032 Q40032_HORVU BLT14.1 protein tr A0A1E5VYJ5 A0A1E5VYJ5_9POAL … Nettetgi 700160887 gb GBSS01000153.1 GTGGGTGATCGATTTACG CCCTAAGGAAAACCAGGA 142 (TCT)12 leguminosin group485 secreted peptide …

Did you know?

http://psd.uohyd.ac.in/tgv/main/searchResult.php?ch=SL3.0ch04 NettetGene ID: 11421172, updated on 20-Apr-2024 Summary Other designations proline-rich receptor-like protein kinase PERK2, leguminosin group485 secreted peptide

Nettet27. aug. 2010 · We identify a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. We name these peptides root meristem growth factors (RGFs). NettetLeguminosin group485 secreted peptide, G7IPN6_MEDTR AT30 CATGAGGCGTCCGTCGTTATGGAACT See AS40 5.06 65873 263 Uncharacterized protein, I1KG32_SOYBN

Nettet31. okt. 2024 · Leguminosin group485 secreted peptide: M0118, 132: −3.13: 1.75E−06: Medtr0097s0070: CASP POPTRDRAFT-like protein: M0118, 132: −3.04: 4.96E−06: … Nettet1. okt. 2024 · comprised entirely of genes that were down regulated at 24 and 48 h post-inoculation. The identity of the genes in these modules suggest that down-regulating …

NettetConsolidated transcript/protein view: LotjaGi2g1v0278000.1 is a Leguminosin group485 secreted peptide; TAIR: AT5G09520.1 hydroxyproline-rich glycoprotein family protein; …

Nettet1. jun. 2006 · Arabidopsis seed germination is also promoted by PHYA if the phytochrome is allowed to accumulate during a prolonged imbibition (Oh et al., 2004; Shinomura et … rediffmail account creationhttp://prgdb.org/prgdb4/expression/Canto-Pastor%C2%A0et%C2%A0al.,%202424 rediffmail app for windows 11NettetUniProtKB. x; UniProtKB. Protein knowledgebase. UniParc. Sequence archive. Help. Help pages, FAQs, UniProtKB manual, documents, news archive and Biocuration projects. rediffmail apkNettetProtein Length: 94: SignalP D-value: 0.809: SSP Type: putative SSP: SSP Gene Family Name: Family_01: Putative SSP Family ID: Family_01: Annotation: leguminosin … riced butternut squash recipesNettetMTR_5g077315 leguminosin group485 secreted peptide [ (barrel medic)] Gene ID: 25494874, discontinued on 19-Apr-2024. Summary. Gene provides a unified query … rediffmail aqmNettet27. jun. 2016 · leguminosin group485 secreted peptide. probable wrky transcription factor 33-like. universal stress protein a-like. atp-dependent dna helicase pif1. … rediffmail a next generationNettetNascent polypeptide-associated complex subunit beta-SL3.0ch04: 2663576 - 2668939: 2668940 - 2671940: Solyc04g009170.2: RING/U-box superfamily protein + SL3.0ch04: 2671541 - 2676566: 2668540 - 2671540: Solyc04g009180.2: TCP transcription factor 14 + SL3.0ch04: 2686905 - 2688461: 2683904 - 2686904: Solyc04g009190.3: UPF0664 … riced califlowere fridge paper bag